during the ted talk he spoke about how DNA can be programed just like a compter, in the same way a programer what a code in a compiler than into bianary whitch the computer can read.
this is amasing to me because i am a computer programer and the fact that this proses can be aplyed to DNA an organic meterial, just amagin what can come out of this (organic computers, reprograming damiged DNA, masive amounts of data storige.
Binary
0110100001100101011011000110110001101111
C programing language
long some_function();
/* int */ other_function();
DNA
ATGACGTTAACCGCTAACTAG
