DNA and Computer programing TED talk

In class i had the chance to whatch a ted talk about how a groop of peaple are programing for DNA and crate amasing things.

during the ted talk he spoke about how DNA can be programed just like a compter, in the same way a programer what a code in a compiler than into bianary whitch the computer can read.

this is amasing to me because i am a computer programer and the fact that this proses can be aplyed to DNA an organic meterial, just amagin what can come out of this (organic computers, reprograming damiged DNA, masive amounts of data storige.


Binary
0110100001100101011011000110110001101111

C programing language

long some_function();
/* int */ other_function();

DNA
ATGACGTTAACCGCTAACTAG

Thinking Like A Mountain

Today I read a very interesting chapter from a book it was called Thinking Like A Mountain and it was by Aldo Leopold. The article gets at the hart of how we view predators and how they effect there habitat.

 It was about how he shot a wolf in a time were they where viewed as bad and realized that wolves stop dear from growing out of control and eating all the plants.

 This reminds me that everything is in perfect balance and killing off a predator will let the prey grow in number and require more food which can destabilize an ecosystem.

TED Talk

In the video the speaker Richard Preston talked about how giant redwoods contain vast ecosystems that are teeming with life.

 the redwoods are wider than a road and extremely tall some evin reach 240 feet or taller because of this the trees are moastly unexplored. The redwoods themselves are thousands of years old. the canopy's are there own ecosystem capable of soporting life some of that life is undescuverd.

 i think this is amassing that there is self contained ecosystems in the world pokits of life living on indefinitely without recorceses from out side sorces.